Nomascus leucogenys (Northern white-cheeked gibbon) U6 spliceosomal RNA (ENSNLEG00000031522.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (Northern white-cheeked gibbon) U6 spliceosomal RNA (ENSNLEG00000031522.1) URS00006D6560_61853

106 nucleotides
2 databases (Ensembl, Rfam)
Found in 4 other species
33 publications
1. sncRNA
2. snRNA
3. u6 snRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUGCUUGCUUCAACAGCAUGUAUACUAAAUUUAGAACAAACGGAGAAGAUUAGCAUGGCUACUGUGCAAGGAUGACACACAAAUUUGUGAAACAUUCCAUAUUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Gorilla gorilla gorilla U6 spliceosomal RNA (ENSGGOG00000033085.2)
Homo sapiens U6 spliceosomal RNA
Pan paniscus (bonobo) U6 spliceosomal RNA (ENSPPAG00000019689.1)
Pan troglodytes U6 spliceosomal RNA (ENSPTRG00000037479.2)

2D structure

Publications