Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Equus caballus (horse) mir-30 microRNA precursor secondary structure diagram

Equus caballus (horse) mir-30 microRNA precursor URS00006D4A6F_9796

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUACACUCUCAGCUGUGAGCUCAAGGUGGCUGGGAGAGGGUUGUUUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Ailuropoda melanoleuca (giant panda) mir-30 microRNA precursor
  2. Callithrix jacchus (white-tufted-ear marmoset) mir-30 microRNA precursor
  3. Canis lupus familiaris mir-30 microRNA precursor
  4. Cricetulus griseus (Chinese hamster) mir-30 microRNA precursor
  5. Dipodomys ordii (Ord's kangaroo rat) mir-30 microRNA precursor
  6. Erinaceus europaeus (western European hedgehog) mir-30 microRNA precursor
  7. Felis catus mir-30 microRNA precursor
  8. Fukomys damarensis (Damara mole-rat) mir-30 microRNA precursor
  9. Gorilla gorilla gorilla (western lowland gorilla) mir-30 microRNA precursor
  10. Heterocephalus glaber (naked mole-rat) mir-30 microRNA precursor
  11. Homo sapiens mir-30 microRNA precursor
  12. Loxodonta africana (African savanna elephant) mir-30 microRNA precursor
  13. Macaca mulatta mir-30 microRNA precursor
  14. Mus musculus (house mouse) mir-30 microRNA precursor
  15. Myotis brandtii mir-30 microRNA precursor
  16. Myotis davidii mir-30 microRNA precursor
  17. Myotis lucifugus (little brown bat) mir-30 microRNA precursor
  18. Neotoma lepida mir-30 microRNA precursor
  19. Nomascus leucogenys (Northern white-cheeked gibbon) mir-30 microRNA precursor
  20. Oryctolagus cuniculus (rabbit) mir-30 microRNA precursor
  21. Otolemur garnettii mir-30 microRNA precursor
  22. Pan troglodytes mir-30 microRNA precursor
  23. Papio anubis mir-30 microRNA precursor
  24. Pongo abelii mir-30 microRNA precursor
  25. Pteropus alecto (black flying fox) mir-30 microRNA precursor
  26. Rattus norvegicus (Norway rat) mir-30 microRNA precursor
  27. Tupaia chinensis (Chinese tree shrew) mir-30 microRNA precursor
2D structure Publications