Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 114-22 (SNORD114-22) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 114-22 (SNORD114-22) URS00006CE133_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD114-22: SNORD114-22 is a downregulated small nucleolar RNA (snoRNA) identified in ACC samples [PMC5607708]. It is one of the differentially affected snoRNAs in ACC, along with snoRD114-9, snoRD114-12, and snoRD66 [PMC5607708]. SNORD114-22 is strongly positively correlated with intratumoral T cell-mediated cytotoxicity by granzyme [PMC9149963]. It acts as a regulatory factor through methylation and pseudouridylation [PMC6767209]. SNORD114-22 is one of the genes expressed in hPDLSCs-MOR but not in hPDLSCs-CTR, along with HIGD1C, PAGE2, SNORA1, SNORA32, SNORD104, SNORA116-15, SNORD116-23, TEX29, and C21orf140 [PMC6767209]. It is also one of the small nucleolar RNAs (snoRNAs) that include SNORD78, SNORD93, SNORD43, and others [PMC7461500]. The DLK1-DIO3 locus shows upregulation of DLK1 and expression of MEG3 as well as SNORD113-3 and SNORD114-22 [PMC9267054]. In warts compared to normal skin samples, the genes that are similarly hypomethylated include SNORD114-22 along with SNORD70 and SNORD114-31 [PMC7783806].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAUCGAUGAUGACUACCGGUGGCGUAUGAGUCAUAUGUGAUGAAUACGUGUUUGGAACUCUGAGGUCCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications