Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 114-22 (SNORD114-22) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 114-22 (SNORD114-22) URS00006CE133_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

snord114-22: SNORD114-22 is a small nucleolar RNA (snoRNA) involved in the regulatory processes of methylation and pseudouridylation within cells [PMC6767209]. In the context of adrenocortical carcinoma (ACC) samples, SNORD114-22 was identified as one of the four snoRNAs that were significantly downregulated [PMC5607708]. This snoRNA, along with others, has been found to have a strong positive correlation with T cell-mediated cytotoxicity in tumors, as indicated by granzyme levels [PMC9149963]. In human periodontal ligament stem cells modified to overexpress the ยต-opioid receptor (hPDLSCs-MOR), SNORD114-22 is one of the genes uniquely expressed compared to control cells (hPDLSCs-CTR), suggesting a role in cellular differentiation or response to environmental changes [PMC6767209]. Furthermore, SNORD114-22 has been associated with an upregulation at the DLK1-DIO3 genomic locus, which is known for its involvement in growth and development [PMC9267054]. Lastly, research on skin warts has revealed that SNORD114-22 is hypomethylated compared to normal skin tissue, which could have implications for its expression and function in epidermal biology or pathology [PMC7783806].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAUCGAUGAUGACUACCGGUGGCGUAUGAGUCAUAUGUGAUGAAUACGUGUUUGGAACUCUGAGGUCCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression