v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Macaca fascicularis (Crab-eating macaque) small nucleolar RNA, C/D box 95 (ENSMFAG00000015699.2) secondary structure diagram

Macaca fascicularis (Crab-eating macaque) small nucleolar RNA, C/D box 95 (ENSMFAG00000015699.2) URS00006CCF53_9541

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGGCGGUGAUGACCCCAACAUGCCAUCUGAGUGUCGGUGCUGAAAUCCAGAGGCUGUUUCUGAGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Cercocebus atys (Sooty mangabey) snoRNA (ENSCATG00000018561.1)
  2. Chlorocebus sabaeus (African green monkey) small nucleolar RNA, C/D box 95 (ENSCSAG00000021873.1)
  3. Gorilla gorilla gorilla small nucleolar RNA, C/D box 95 (ENSGGOG00000029252.2)
  4. Homo sapiens (human) small nucleolar RNA, C/D box 95 (ENSG00000264549.1)
  5. Macaca nemestrina snoRNA (ENSMNEG00000010847.1)
  6. Mandrillus leucophaeus snoRNA (ENSMLEG00000014723.1)
  7. Nomascus leucogenys small nucleolar RNA, C/D box 95 (ENSNLEG00000022009.2)
  8. Pan paniscus small nucleolar RNA, C/D box 95 (ENSPPAG00000007298.1)
  9. Pan troglodytes small nucleolar RNA, C/D box 95 (ENSPTRG00000033118.2)
  10. Papio anubis snoRNA (ENSPANG00000012524.3)
  11. Piliocolobus tephrosceles (Ugandan red Colobus) snoRNA (ENSPTEG00000017925.1)
  12. Pongo abelii snoRNA (ENSPPYG00000022663.2)
  13. Rhinopithecus bieti (Black snub-nosed monkey) snoRNA (ENSRBIG00000001106.1)
  14. Rhinopithecus roxellana (Golden snub-nosed monkey) snoRNA (ENSRROG00000016954.1)
  15. Theropithecus gelada (gelada) small nucleolar RNA SNORD95 (ENSTGEG00000020073.1)
 2D structure Publications