v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nomascus leucogenys tRNA-Ile (AAT) (tRNA-Ile-AAT-2-1, tRNA-Ile-AAT-2-2) secondary structure diagram

Nomascus leucogenys tRNA-Ile (AAT) (tRNA-Ile-AAT-2-1, tRNA-Ile-AAT-2-2) URS00006C8412_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCCGGUUAGCUCAGUUGGUUAGAGCGUGGUGCUAAUAACGCCAAGGUCGCGGGUUCGAUCCCCGUACUGGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Alosa alosa tRNA-Ile
  2. Balaenoptera acutorostrata scammoni tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 4)
  3. Ceratotherium simum simum tRNA-Ile (AAT) (tRNA-Ile-AAT-1-1)
  4. Danionella translucida tRNA-Ile
  5. Danio rerio tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 6)
  6. Gasterosteus aculeatus tRNA
  7. Gorilla gorilla gorilla tRNA-Ile (AAT) (tRNA-Ile-AAT-2 1 to 3)
  8. Hippoglossus stenolepis (Pacific halibut) tRNA-Ile
  9. Homo sapiens tRNA-Ile (anticodon AAT) 2-1 (TRI-AAT2-1)
  10. Merluccius polli tRNA-Ile
  11. Perca flavescens (yellow perch) tRNA-Ile
  12. Perca fluviatilis tRNA-Ile
  13. Pleuronectes platessa (European plaice) tRNA-Ile
  14. Pongo abelii tRNA-Ile (AAT) (tRNA-Ile-AAT-1-1, tRNA-Ile-AAT-1-2)
  15. Xenopus laevis (African clawed frog) tRNA
  16. Xenopus tropicalis tRNA-Ile (AAT) (tRNA-Ile-AAT-1-1)
 2D structure Publications