Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla gorilla (western lowland gorilla) microRNA mir-154 secondary structure diagram

Gorilla gorilla gorilla (western lowland gorilla) microRNA mir-154 URS00006C4C37_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUAUUUAAAAGGUGGAUAUUCCUUCUAUGUUUAUGUUAUUUAUGGUUAAACAUAGAGGAAAUUCCACGUUUUCAGUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Canis lupus familiaris microRNA mir-154
  2. Chlorocebus sabaeus microRNA mir-154
  3. Homo sapiens microRNA mir-154
  4. Loxodonta africana (African savanna elephant) microRNA mir-154
  5. Macaca mulatta (Rhesus monkey) microRNA mir-154
  6. Mustela putorius furo (domestic ferret) microRNA mir-154
  7. Nomascus leucogenys microRNA mir-154
  8. Otolemur garnettii (small-eared galago) microRNA mir-154
  9. Pan troglodytes microRNA mir-154
  10. Papio anubis (Olive baboon) microRNA mir-154
  11. Pongo abelii microRNA mir-154
2D structure Publications