Pongo abelii (Sumatran orangutan) microRNA 517a (ENSPPYG00000030539.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo abelii (Sumatran orangutan) microRNA 517a (ENSPPYG00000030539.1) URS00006C1AF2_9601

87 nucleotides
3 databases (ENA, Ensembl, Rfam)
Found in 4 other species
123 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UCUCAGGCAGUGACCCUCUAGAUGGAAGCACUGUCUGUUGUAUAAAAGAAAAGAUCGUGCAUCCCUUUAGAGUGUUACUGUUUGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Homo sapiens microRNA hsa-mir-517a precursor
Pan paniscus microRNA 517a (ENSPPAG00000004919.1)
Pan troglodytes ptr-mir-517a (ENSPTRG00000045475.1)
Pongo pygmaeus microRNA ppy-mir-517a precursor

Publications