Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla gorilla tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1) secondary structure diagram

Gorilla gorilla gorilla tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1) URS00006C14B2_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAGUCGUGGCCGAGUGGUUAAGGCGAUGGACUAGAAAUCCAUUGGGGUUUCCCCGCGCAGGUUCGAAUCCUGCCGACUACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 58 other species

  1. Acropora millepora (Stony coral) tRNA-Ser
  2. Albula goreensis tRNA-Ser
  3. Anas platyrhynchos tRNA
  4. Anguilla anguilla tRNA-Ser
  5. Balaenoptera acutorostrata scammoni tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  6. Bos taurus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  7. Callipepla squamata (scaled quail) tRNA
  8. Callithrix jacchus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  9. Camelus ferus tRNA
  10. Carlito syrichta tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  11. Ceratotherium simum simum tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 4)
  12. Chlorocebus sabaeus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  13. Colinus virginianus tRNA
  14. Colius striatus tRNA
  15. Danio rerio tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 9)
  16. Dasypus novemcinctus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  17. Dipodomys ordii tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  18. Echinops telfairi tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 3)
  19. Eptesicus nilssonii tRNA-Ser
  20. Equus caballus tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 4)
  21. Erinaceus europaeus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  22. Felis catus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  23. Gallus gallus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  24. Homo sapiens tRNA-Ser (anticodon AGA) 1-1 (TRS-AGA1-1)
  25. Loxodonta africana tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 3)
  26. Macaca mulatta tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  27. Megalops atlanticus (tarpon) tRNA-Ser
  28. Meleagris gallopavo tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  29. Monodelphis domestica tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  30. Mus musculus castaneus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  31. Mus musculus domesticus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  32. Mus musculus musculus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  33. Mus musculus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  34. Mus spretus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  35. Mustela putorius furo tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  36. Myotis brandtii tRNA
  37. Myotis davidii tRNA
  38. Myotis lucifugus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  39. Nomascus leucogenys tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  40. Ochotona princeps tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  41. Ornithorhynchus anatinus tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  42. Oryctolagus cuniculus tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 3)
  43. Otolemur garnettii tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  44. Ovis aries tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  45. Pan troglodytes tRNA-Ser (AGA) (tRNA-Ser-AGA-2-1, tRNA-Ser-AGA-4-1)
  46. Papio anubis tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  47. Pongo abelii tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  48. Procavia capensis tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  49. Pteropus alecto (black flying fox) tRNA
  50. Sorex araneus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  51. Stylophora pistillata tRNA-Ser
  52. Sus scrofa tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  53. Trichechus manatus latirostris tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 3)
  54. Tupaia chinensis tRNA
  55. Tursiops truncatus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  56. Vicugna pacos tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 6)
  57. Xenopus laevis (African clawed frog) tRNA
  58. Xenopus tropicalis tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
2D structure Publications