Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Loxodonta africana (African savanna elephant) microRNA mir-423 secondary structure diagram

Loxodonta africana (African savanna elephant) microRNA mir-423 URS00006C130C_9785

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGAAGUUAGGCUGAGGGGCAGAGAGCGAGACUUUUCUAUUUUCCAAAAGCUCGGUCUGAGGCCCCUCAGUCUUGCUUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Ailuropoda melanoleuca (giant panda) microRNA mir-423
  2. Bos taurus microRNA mir-423
  3. Callithrix jacchus microRNA mir-423
  4. Camelus ferus microRNA mir-423
  5. Canis lupus familiaris (dog) microRNA mir-423
  6. Capra hircus (goat) microRNA mir-423
  7. Cavia porcellus microRNA mir-423
  8. Chlorocebus sabaeus microRNA mir-423
  9. Cricetulus griseus (Chinese hamster) microRNA mir-423
  10. Dipodomys ordii (Ord's kangaroo rat) microRNA mir-423
  11. Equus caballus microRNA mir-423
  12. Erinaceus europaeus microRNA mir-423
  13. Felis catus (domestic cat) microRNA mir-423
  14. Fukomys damarensis (Damara mole-rat) microRNA mir-423
  15. Gorilla gorilla gorilla (western lowland gorilla) microRNA mir-423
  16. Gorilla gorilla (western gorilla) microRNA mir-423
  17. Heterocephalus glaber (naked mole-rat) microRNA mir-423
  18. Homo sapiens microRNA mir-423
  19. Macaca mulatta microRNA mir-423
  20. Mesocricetus auratus microRNA mir-423
  21. Mus musculus (house mouse) microRNA mir-423
  22. Myotis brandtii microRNA mir-423
  23. Myotis davidii microRNA mir-423
  24. Myotis lucifugus microRNA mir-423
  25. Neotoma lepida microRNA mir-423
  26. Nomascus leucogenys microRNA mir-423
  27. Oryctolagus cuniculus microRNA mir-423
  28. Otolemur garnettii (small-eared galago) microRNA mir-423
  29. Ovis aries microRNA mir-423
  30. Pan troglodytes microRNA mir-423
  31. Papio anubis microRNA mir-423
  32. Pongo abelii (Sumatran orangutan) microRNA mir-423
  33. Pongo pygmaeus (Bornean orangutan) microRNA mir-423
  34. Pteropus alecto (black flying fox) microRNA mir-423
  35. Rattus norvegicus microRNA mir-423
  36. Ictidomys tridecemlineatus microRNA mir-423
  37. Tupaia chinensis microRNA mir-423
2D structure Publications