Bos grunniens (domestic yak) microRNA 184 (ENSBGRG00000021755.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos grunniens (domestic yak) microRNA 184 (ENSBGRG00000021755.1) URS00006BFA26_30521

83 nucleotides
1 database (Ensembl)
Found in 7 other species
97 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CCAGUCACAUCCCCUUAUCACUUUUCCAGCCAGCUUUGUGACUCUAACUGUUGGACGGAGAACUGAUAAGGGUAGGUGAUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Bison bison bison miRNA (ENSBBBG00000011531.1)
Bos indicus x Bos taurus miRNA (ENSBIXG00000013723.1, ENSBIXG00005015517.1)
Bos mutus miRNA (ENSBMUG00000026446.1)
Bos taurus microRNA bta-mir-184 precursor
Capra hircus microRNA chi-mir-184 precursor
Moschus moschiferus (Siberian musk deer) microRNA 184 (ENSMMSG00000021844.1)
Ovis aries miRNA (ENSOARG00000024178.1, ENSOARG00020022873.2)

Publications