Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 71C (ENSG00000201512.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 71C (ENSG00000201512.1) URS00006BEDDC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA71C: SNORA71C is a small nucleolar RNA (snoRNA) that belongs to the H/ACA box family [PMC6466398]. It has been found to be upregulated in glioblastoma (GBM) upon retinoic acid and/or thalidomide treatment [PMC5747948]. However, in head and neck squamous cell carcinoma (HNSCC), a different form of SNORA71C with a nucleotide mutation has been identified [PMC6466398]. SNORA71C has also been found to be upregulated in breast cancer (BC) tissues compared to normal breast tissues [PMC10106978]. Knocking down SNORA71C in BC cells resulted in decreased levels of GPX4 and PTGS2 proteins, as well as increased cell death [PMC10106978]. It has been suggested that SNORA71C promotes the proliferation, migration, and invasion of BC cells by interacting with RUNX1 [PMC10106978]. In chronic lymphocytic leukemia (CLL), SNORA71C is downregulated compared to normal B cells [PMC9219770]. Additionally, dysregulated snoRNAs, including SNORA71C, have been associated with shorter progression-free survival in CLL patients [PMC8975097]. Overall, SNORA71C is a snoRNA that plays a role in various biological processes and may serve as a potential biomarker and therapeutic target for BC treatment.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCUGCAUUCGAAAGUGAUCAUGAGCUGCCCGUGCCCUGGUCAUUGGUAGUGCAGGGAGAGGAACUGCCGAGAGCACUUCCCCGUGUUUGGAGGGUCCACUCCUGUCUCUUCCAAACCCUGGAGCUUUCCCACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications