Callithrix jacchus (white-tufted-ear marmoset) microRNA mir-190

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) microRNA mir-190 URS00006BD364_9483

86 nucleotides
1 database (Rfam)
Found in 4 other species
489 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGCCUGCUUCUGUGUGAUAUGUUUGAUAUUGGGUUGUUUAAUUAGGAACCAACUAAAUGUCAAACAUAUUCUUACAGCAGCAGGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Gorilla gorilla gorilla microRNA mir-190
Homo sapiens microRNA mir-190
Pan troglodytes microRNA mir-190
Pongo abelii microRNA mir-190

Publications