Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 90 (ENSG00000212447.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 90 (ENSG00000212447.1) URS00006BB86E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD90: SNORD90 is a type of small nucleolar RNA (snoRNA) that is upregulated in SH-SY5Y FUS KO cells and is also enriched in sporadic ALS patients [PMC9941101]. In SH-SY5Y FUS KO cells, elevated levels of SNORD90 were observed alongside hypermethylation of 18S-Um354 and 18S-Cm1272, which are the corresponding guide snoRNAs [PMC9941101]. SNORD90 expression and methylation at SSU-U354 were found to differ in DLBCL cell lines compared to RLNs (reactive lymph nodes) [PMC8210301]. DLBCL tumor samples also showed considerable variation in SNORD90 expression and methylation at SSU-U354, with the mean value falling between that of cell lines and RLNs [PMC8210301]. SNORD90 is a box C/D snoRNA that guides the 2'-O-methylation of rRNA, along with other snoRNAs such as SNORD20, SNORD69, SNORD63, and SNORD101 [PMC8188706]. These snoRNAs are found in significant amounts in EV-enriched sweat samples, with SNORD20 representing over 40% of the total snoRNAs present [PMC8188706].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUAAGUUUUCUAAGUGUCUAAUGAUGAAUUUCAUAGGGCAGAUUCUGAGGUGAAAAUUUAAUUCAUCACUGAUACUCCUACUGUGGAAUCUGAAGACACUUGAAAACGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications