Chlorocebus sabaeus microRNA mir-33

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chlorocebus sabaeus microRNA mir-33 URS00006B9362_60711

67 nucleotides
1 database (Rfam)
Found in 7 other species
1033 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CCGCGGUGCAUUGCUGUUGCAUUGCACGUGUGUGAGGCGGGUGCAGUGCCUCGGCAGUGCAGCCCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Equus caballus (horse) microRNA mir-33
Gorilla gorilla gorilla microRNA mir-33
Homo sapiens microRNA mir-33
Macaca mulatta microRNA mir-33
Nomascus leucogenys microRNA mir-33
Pan troglodytes microRNA mir-33
Papio anubis (Olive baboon) microRNA mir-33

Publications