Rhinopithecus bieti (Black snub-nosed monkey) U2 spliceosomal RNA (ENSRBIG00000027601.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rhinopithecus bieti (Black snub-nosed monkey) U2 spliceosomal RNA (ENSRBIG00000027601.1) URS00006A3E7F_61621

191 nucleotides
1 database (Ensembl)
Found in 10 other species
1. sncRNA
2. snRNA
3. u2 snRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AUCGCUUCUCGGCCUUUUGGCUAAGAUCAAGUGUAGUAUCUGUUCUUAUCAGUUUAAUAUCUGAUACGUCCUCUAUCCGAGGACAAUAUAUUAAAUGGAUUUUUGGAGCAGGGAGAUGGAAUAGGAGCUUGCUCCGUCCACUCCACGCAUCGACCUGGUAUUGCAGUACCUCCAGGAACGGUGCACCCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Gorilla gorilla U2 spliceosomal RNA
Homo sapiens U2 spliceosomal RNA (multiple genes)
Macaca fascicularis (Crab-eating macaque) U2 spliceosomal RNA (multiple genes)
Macaca mulatta U2 spliceosomal RNA (multiple genes)
Nomascus leucogenys U2 spliceosomal RNA (ENSNLEG00000025491.1)
Pan troglodytes U2 spliceosomal RNA (ENSPTRG00000044342.1)
Papio anubis (Olive baboon) U2 spliceosomal RNA
Papio hamadryas (hamadryas baboon) U2 spliceosomal RNA
Patagioenas fasciata monilis U2 spliceosomal RNA
Theropithecus gelada U2 spliceosomal RNA (ENSTGEG00000014694.1)

2D structure