Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) snoRNA (ENSG00000212161.1) secondary structure diagram

Homo sapiens (human) snoRNA (ENSG00000212161.1) URS00006A2B14_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD64: SNORD64 is a C/D box small nucleolar RNA (snoRNA) gene located in the PWS/AS imprinted domain [PMC3077502]. It is one of the snoRNAs expressed in this domain, along with SNORD107, SNORD108, SNORD109A, and SNORD109B [PMC3319576]. These snoRNAs are involved in various biological processes and have been found to be upregulated in certain diseases, such as ERG-related BCP-ALL [PMC9219770]. Studies have shown that the expression of SNORD64 and other protein-coding genes at the PWS locus is not perturbed [PMC8037846]. Additionally, chimeric mice with a 5′LoxP cassette inserted downstream from SNORD64 did not exhibit discernible phenotypic differences [PMC4742849]. The snoRNA genes located within the large SNURF-SNRPN transcripts are present not only as single copies but also in two snoRNA gene clusters (SNORD115 and SNORD116) [PMC5073158]. In PWS INS-1 lines with complete loss of expression, including Snurf, Snrpn, Ipw, Mkrn3, all four snoRNAs (Snord116, Snord115, Snord107 and SNORD64), miRNA (Mir344 isoforms), and duplicated U1-Snurf sequences are affected [PMC10138222]. These findings highlight the importance of snoRNAs like SNORD64 in various biological processes and disease states.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAUUUAUAAUGAGCUGUGUUUACUGAGCAUUAUGAAGUAAAGUUCAAUAUGAUUACUCUGAAGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

2D structure Publications