Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-642a precursor URS000069A81A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR642A: MIR642A is a microRNA that has been found to be downregulated in multiple myeloma (MM) patients [PMC5395780]. It has been shown to modulate the expression of DEPTOR, a protein involved in the regulation of cell size and endoplasmic reticulum (ER) mass [PMC5395780]. The downregulation of DEPTOR by transfection of MM cells with miR135b or MIR642A resulted in the downregulation of IRF4 and k light chain proteins, indicating a role for MIR642A in modulating the transcriptional program of myeloma cells [PMC5395780]. Luciferase reporter assays and gain-of-function experiments confirmed that transfection of miR135b and MIR642A decreased DEPTOR levels in myeloma cells [PMC5395780]. Furthermore, knockdown of MIR642A and miR135b resulted in increased DEPTOR expression, providing further evidence for their role in controlling DEPTOR levels [PMC5395780]. The 3'UTR of DEPTOR contains binding sites for both MIR642A and miR135b, as confirmed by luciferase reporter assays [PMC5395780]. These findings suggest that the downregulation of MIR642A and miR135b may contribute to the overexpression of DEPTOR observed in MM patients [PMC5395780].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCUGAGUUGGGAGGGUCCCUCUCCAAAUGUGUCUUGGGGUGGGGGAUCAAGACACAUUUGGAGAGGGAACCUCCCAACUCGGCCUCUGCCAUCAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications