Pan paniscus (bonobo) U7 small nuclear RNA (ENSPPAG00000005211.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (bonobo) U7 small nuclear RNA (ENSPPAG00000005211.1) URS0000696DCE_9597

63 nucleotides
1 database (Ensembl)
Found in 2 other species
1. sncRNA
2. snRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UAGUGUUACAGCUCUUUUAGAAUUUUGUCUAGCAGGUUUUCCGAUCUUUACUGGGAAGCCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Homo sapiens U7 small nuclear RNA
Pan troglodytes U7 small nuclear RNA

2D structure