Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) snoRNA (ENSG00000251922.1) secondary structure diagram

Homo sapiens (human) snoRNA (ENSG00000251922.1) URS0000695A7B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA14: SNORA14 is a small nucleolar RNA (snoRNA) that has been studied in Xenopus tropicalis and humans. In Xenopus tropicalis, SNORA14, along with SNORA28 and SCARNA4, is found within introns and can modify ribosomal RNA (rRNA) [PMC6298559]. In a bioinformatics analysis of vertebrate snoRNAs, amphibian and zebrafish SNORA14 were identified as potential guide RNAs for pseudouridylation of 18S rRNA at a specific position [PMC6298559]. When Xenopus SNORA14 was expressed in HeLa cells, pseudouridylation of human 18S rRNA at that position was observed [PMC6298559]. In the context of the lncRNA-target regulatory network, upregulated MSTRG.14719.6 was found to target genes encoding small nucleolar RNAs (SNORDs) and small nucleolar RNAs (SNORAs), including SNORA14 [PMC6123486]. The ribonucleoprotein DYSKERIN was found to bend the SNORA14 transcript in vivo, bringing two pseudouridylation loops close to each other [PMC4931010]. Despite its conservation, SNORA14 has lost its modification activity on rRNA at a highly conserved region [PMC6984369]. Interestingly, when expressed exogenously from a plasmid in Xenopus tropicalis, SNORA14 was able to modify corresponding positions in yeast as well [PMC6984369].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGCAUCUUAGAACAUCCAGGAGACAGUCUUCUAAAAUACCAGUGAGUGGCAAGAUAUGAGUAAAUUCCACAGGAAAAGGAAGGCAGUCCAAAGGGCUGUGCUUCUCCUGUGGCUCAGUGUUAUUCAUAGCUGUGACAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes Small nucleolar RNA SNORA14
2D structure Publications