Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) Small nucleolar RNA SNORD42 (ENSG00000201209.1) secondary structure diagram

Homo sapiens (human) Small nucleolar RNA SNORD42 (ENSG00000201209.1) URS0000693C26_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD42: SNORD42 is a small nucleolar RNA (snoRNA) that has been identified as a potential biomarker for prognosis and a target for therapy in various cancers, including lung cancer and acute myeloid leukemia (AML) [PMC5930448] [PMC8125340]. It has been found to be upregulated in AML and associated with poor survival in lung cancer [PMC5930448]. Suppression of oncogenic SNORD42 in non-small cell lung cancer has been shown to increase apoptosis through a p53-dependent mechanism, while SNORD114-1 promotes cell growth by affecting cell cycle regulation [PMC5390076]. SNORD42 has been established to have an oncogenic function in maintaining lung cancer carcinogenesis [PMC9655370]. Additionally, SNORD42 and SNORD21 have been reported as promising predictive biomarkers for prognosis in colorectal cancer patients [PMC6629867]. Correlations have been found between the region where SNORD42 is located (chr1q22), commonly amplified in plasma cell dyscrasias, and its oncogenic role in lung tumorigenesis [PMC8629011]. Furthermore, snoRNA expression can be influenced by tumor-specific genomic alterations, such as downregulation of snoRNAs in B-cell lymphoma or chromosomal gains of SNORD42 in multiple myeloma [PMC8629011]. Several snoRNAs, including SNORD78, SNORD71A, and SNORD42, have been associated with non-small cell lung cancer proliferation, migration, and invasion [PMC7350589]. It is important to note that while some snoRNAs function as tumor suppressors (e.g., U50), others function as oncogenes (e.g., SNORA42) [PMC9826665].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCCCUAAAAUGGAAAAAAUUUAAAAUUACUUAGACAAUGUGAUGUCAUCAAAGGAACCCUAAGUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications