v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla gorilla (Western Lowland Gorilla) small nucleolar RNA, C/D box 125 (ENSGGOG00000032228.2) secondary structure diagram

Gorilla gorilla gorilla (Western Lowland Gorilla) small nucleolar RNA, C/D box 125 (ENSGGOG00000032228.2) URS000068C891_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACCCCUGGCAGCCCCUCCUGAUGAUUCUUCUUCCUGAGCACGCUCAUGAUGAGCAAACUGAGCCUCUAAGAAGUUGACUGAAGGGGCUGCUUCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Aotus nancymaae (Ma's night monkey) snoRNA (ENSANAG00000004329.1)
  2. Cercocebus atys snoRNA (ENSCATG00000021421.1)
  3. Chlorocebus sabaeus small nucleolar RNA, C/D box 125 (ENSCSAG00000026656.1)
  4. Colobus angolensis palliatus snoRNA (ENSCANG00000004684.1)
  5. Homo sapiens small nucleolar RNA, C/D box 125 (SNORD125)
  6. Macaca fascicularis (Crab-eating macaque) small nucleolar RNA, C/D box 125 (ENSMFAG00000006377.2)
  7. Macaca mulatta (Macaque) small nucleolar RNA, C/D box 125 (ENSMMUG00000036707.3)
  8. Macaca nemestrina snoRNA (ENSMNEG00000025472.1)
  9. Mandrillus leucophaeus snoRNA (ENSMLEG00000003490.1)
  10. Pan paniscus small nucleolar RNA, C/D box 125 (ENSPPAG00000003088.1)
  11. Pan troglodytes small nucleolar RNA, C/D box 125 (ENSPTRG00000038553.2)
  12. Piliocolobus tephrosceles (Ugandan red Colobus) snoRNA (ENSPTEG00000024379.1)
  13. Pongo abelii snoRNA (ENSPPYG00000027633.2)
  14. Rhinopithecus roxellana snoRNA (ENSRROG00000024421.1)
  15. Theropithecus gelada small nucleolar RNA SNORD125 (ENSTGEG00000025377.1)
 2D structure Publications