v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Camelus ferus (Wild Bactrian camel) mir-10 microRNA precursor family secondary structure diagram

Camelus ferus (Wild Bactrian camel) mir-10 microRNA precursor family URS000068AEF6_419612

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGCACCCACCCGUAGAACCGACCUUGCGGGGCCUUCGCCGCACACAAGCUCGUGUCUGUGGGUCCGUGUCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Bos taurus (cattle) mir-10 microRNA precursor family
  2. Callithrix jacchus mir-10 microRNA precursor family
  3. Chlorocebus sabaeus mir-10 microRNA precursor family
  4. Dipodomys ordii (Ord's kangaroo rat) mir-10 microRNA precursor family
  5. Equus caballus (horse) mir-10 microRNA precursor family
  6. Gorilla gorilla gorilla mir-10 microRNA precursor family
  7. Homo sapiens mir-10 microRNA precursor family
  8. Loxodonta africana (African savanna elephant) mir-10 microRNA precursor family
  9. Macaca mulatta mir-10 microRNA precursor family
  10. Mesocricetus auratus mir-10 microRNA precursor family
  11. Mus musculus mir-10 microRNA precursor family
  12. Myotis brandtii mir-10 microRNA precursor family
  13. Neotoma lepida mir-10 microRNA precursor family
  14. Nomascus leucogenys (Northern white-cheeked gibbon) mir-10 microRNA precursor family
  15. Otolemur garnettii (small-eared galago) mir-10 microRNA precursor family
  16. Pan troglodytes mir-10 microRNA precursor family
  17. Papio anubis mir-10 microRNA precursor family
  18. Pteropus alecto mir-10 microRNA precursor family
  19. Rattus norvegicus mir-10 microRNA precursor family
  20. Sus scrofa mir-10 microRNA precursor family
  21. Tupaia chinensis (Chinese tree shrew) mir-10 microRNA precursor family
 2D structure Publications