Homo sapiens microRNA mir-188

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens microRNA mir-188 URS0000686139_9606

106 nucleotides
2 databases (GeneCards, MalaCards)
Found in 0 other species
351 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

ACCUCCCGACUUGCUUUCUCUCCUCCAUGCCUUGAGUGUAGGACCGUUGGCAUCUUAAUUACCCUCCCACACCCAAGGCUUGCAGAAGAGCGAGCCUUCUCUUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 0 other species

Callithrix jacchus microRNA mir-188
Nomascus leucogenys microRNA mir-188
Pan paniscus microRNA mir-188
Pan troglodytes (chimpanzee) microRNA mir-188
Pongo abelii (Sumatran orangutan) microRNA mir-188
Pongo pygmaeus (Bornean orangutan) microRNA mir-188

Publications