Saimiri boliviensis boliviensis (Bolivian squirrel monkey) U7 small nuclear RNA (ENSSBOG00000014030.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saimiri boliviensis boliviensis (Bolivian squirrel monkey) U7 small nuclear RNA (ENSSBOG00000014030.1) URS000067F947_39432

62 nucleotides
1 database (Ensembl)
Found in 1 other species
1. sncRNA
2. snRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGGUGUUACAGCUCUUUUAGAAUAUGUCUAGCAGGUUUUUCAGUUUUCACCAGAAUGCCCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Homo sapiens U7 small nuclear RNA

2D structure