Nomascus leucogenys (Northern white-cheeked gibbon) tRNA

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (Northern white-cheeked gibbon) tRNA URS000067CB9E_61853

108 nucleotides
1 database (Rfam)
Found in 3 other species
56 publications
1. sncRNA
2. tRNA
3. leucyl tRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUCAGGAUGGCCGAGUGGUCUAAGGCGCCAGACUCAAGCUUACUGCUUCCUGUGUUCGGGUCUUCUGGUCUCCGUAUGGAGGCGUGGGUUCGAAUCCCACUUCUGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Gorilla gorilla gorilla (western lowland gorilla) tRNA
Homo sapiens tRNA
Pan troglodytes tRNA

2D structure

Publications