Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-644a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-644a precursor URS000067B227_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-644a: Hsa-mir-644a is a microRNA that has been found to target genes such as CHP1, SLC2A3, and C8orf37 [PMC9738797]. It has been shown to be downregulated in certain conditions, indicating increased expression of its target genes [PMC9781133]. Hsa-mir-644a is also associated with seven HUB nodes, including EGFR and TP53 [PMC5630327]. Lentiviral vectors encoding hsa-mir-644a shRNA have been used in experiments to study its function [PMC5226553]. Site-directed mutagenesis has been used to disrupt the hsa-mir-644a target site in a specific construct [PMC5226553]. In certain conditions, the expression levels of hsa-mir-644a have been found to be normalized compared to control subjects [PMC6719224]. Hsa-mir-644a is one of the differentially expressed miRNAs that have been used for hierarchical clustering analysis [PMC6719224]. In HIV-infected breast milk, hsa-mir-644a has been found to be downregulated compared to uninfected milk samples [PMC7395778]. References: [PMC9738797]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9738797/ [PMC9781133]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9781133/ [PMC5630327]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5630327/ [PMC5226553]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5226553/ [PM6719224]: https://www.ncbi.nlm.nih.gov/pmc/articles/PM6719224/ [PM7395778]: https://www.ncbi.nlm.nih.gov/pmc/articles/PM7395778/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUUUUUUUAGUAUUUUUCCAUCAGUGUUCAUAAGGAAUGUUGCUCUGUAGUUUUCUUAUAGUGUGGCUUUCUUAGAGCAAAGAUGGUUCCCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications