Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 19C (ENSG00000222345.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 19C (ENSG00000222345.1) URS0000673CBC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD19: SNORD19 is a box C/D snoRNA that is encoded in an intron of the gnl3 gene [PMC6984369]. It has been identified as a tumor immune infiltration-associated snoRNA in patients with colon cancer [PMC10050728]. The expression levels of SNORD19 are inversely proportional to the tumor immune infiltration score (TIIsno) [PMC8844792]. SNORD19, along with other snoRNAs (SNORD59A, SNORD63B, SNORD100, SNORD99, SNORD63, and SNORD12C), has significantly reduced expression levels in tumors and increased expression levels in immune cells [PMC8844792]. Low expression of SNORD19 is associated with poor prognosis in ovarian cancer patients [PMC6686521]. It has been found to be involved in splicing of two mRNAs and is not correlated with any mRNA [PMC6686521]. Additionally, SNORD19 has been identified as a significantly upregulated snoRNA in various tumors, including colon cancer and uterine corpus endometrial carcinoma (UCEC) [PMC10050728] [PMC6539089] [PMC7400997]. The expression pattern of SNORD19 may have potential for cancer subtyping [PMC6539089]. Overall, the research suggests that SNORD19 plays a role as a tumor immune infiltration-associated snoRNA and may have implications for prognosis and cancer subtyping.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGAAAUGAAGAAACUAAAAUUGGUCUUAGUAUUGAAGUGAAGACACUGAGAUCCAACUCUGAUCUUGCCCUAAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

2D structure Publications