Macaca nemestrina (Pig-tailed macaque) Small nucleolar RNA SNORD14 (ENSMNEG00000000766.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca nemestrina (Pig-tailed macaque) Small nucleolar RNA SNORD14 (ENSMNEG00000000766.1) URS000066E3F5_9545

88 nucleotides
1 database (Ensembl)
Found in 13 other species
42 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UCGCUGUGAUGAGUGAUUGUUAAACAUUCGUAGUUUCCACCAAAAGCUUGGCUAAUGAUGGCAACACCUUCCUUGGAUGUCUGAGCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Cercocebus atys Small nucleolar RNA SNORD14 (ENSCATG00000000532.1)
Chlorocebus sabaeus Small nucleolar RNA SNORD14 (ENSCSAG00000024833.1)
Gorilla gorilla gorilla Small nucleolar RNA SNORD14 (ENSGGOG00000030312.2)
Homo sapiens small nucleolar RNA, C/D box 14C (SNORD14C)
Macaca fascicularis (Crab-eating macaque) Small nucleolar RNA SNORD14 (ENSMFAG00000005139.2)
Macaca mulatta Small nucleolar RNA SNORD14 (ENSMMUG00000026596.3)
Mandrillus leucophaeus Small nucleolar RNA SNORD14 (ENSMLEG00000019286.1)
Nomascus leucogenys Small nucleolar RNA SNORD14 (ENSNLEG00000021331.2)
Pan troglodytes Small nucleolar RNA SNORD14 (ENSPTRG00000025585.2)
Papio anubis (olive baboon) Small nucleolar RNA SNORD14 (ENSPANG00000029708.2)
Rhinopithecus bieti (Black snub-nosed monkey) Small nucleolar RNA SNORD14 (ENSRBIG00000019381.1)
Rhinopithecus roxellana Small nucleolar RNA SNORD14 (ENSRROG00000011576.1)
Theropithecus gelada Small nucleolar RNA SNORD14 (ENSTGEG00000026685.1)

2D structure

Publications