v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pongo abelii (Sumatran orangutan) mir-30 microRNA precursor secondary structure diagram

Pongo abelii (Sumatran orangutan) mir-30 microRNA precursor URS000066AE98_9601

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCUAAGCUUUCAGUCAGAUGUUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Chlorocebus sabaeus mir-30 microRNA precursor
  2. Gorilla gorilla gorilla (western lowland gorilla) mir-30 microRNA precursor
  3. Homo sapiens mir-30 microRNA precursor
  4. Macaca mulatta mir-30 microRNA precursor
  5. Nomascus leucogenys mir-30 microRNA precursor
  6. Otolemur garnettii mir-30 microRNA precursor
  7. Pan troglodytes mir-30 microRNA precursor
 2D structure Publications