Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Callorhinchus milii tRNA-Ser (GCT) (tRNA-Ser-GCT-5-1) secondary structure diagram

Callorhinchus milii tRNA-Ser (GCT) (tRNA-Ser-GCT-5-1) URS0000664EAD_7868

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACGAGGUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCACCUUCGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Anolis carolinensis tRNA-Ser (GCT) (tRNA-Ser-GCT-3-1, tRNA-Ser-GCT-3-2)
  2. Astyanax mexicanus (Mexican tetra) tRNA
  3. Balaenoptera acutorostrata scammoni tRNA-Ser (GCT) (tRNA-Ser-GCT-5-1)
  4. Bos taurus tRNA-Ser (GCT) (tRNA-Ser-GCT-5-1)
  5. Callithrix jacchus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  6. Cervus elaphus hippelaphus tRNA-Ser
  7. Chlorocebus sabaeus tRNA-Ser (GCT) (tRNA-Ser-GCT-4-1)
  8. Choloepus hoffmanni tRNA-Ser (GCT) (tRNA-Ser-GCT-3-1)
  9. Dasypus novemcinctus tRNA-Ser (GCT) (tRNA-Ser-GCT-3-1)
  10. Dipodomys ordii tRNA-Ser (GCT) (tRNA-Ser-GCT-3-1)
  11. Echinops telfairi tRNA-Ser (GCT) (tRNA-Ser-GCT-3-1)
  12. Ficedula albicollis tRNA
  13. Gallus gallus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  14. Homo sapiens tRNA-Ser (anticodon GCT) 2-1 (TRS-GCT2-1)
  15. Macaca mulatta tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1)
  16. Microcebus murinus tRNA-Ser (GCT) (tRNA-Ser-GCT-5-1)
  17. Mus caroli tRNA-Ser (GCT) (tRNA-Ser-GCT-5-1)
  18. Mus musculus castaneus tRNA-Ser (GCT) (tRNA-Ser-GCT-5-1)
  19. Mus musculus domesticus tRNA-Ser (GCT) (tRNA-Ser-GCT-5-1)
  20. Mus musculus musculus tRNA-Ser (GCT) (tRNA-Ser-GCT-5-1)
  21. Mus musculus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1, tRNA-Ser-GCT-5-1)
  22. Mus spretus tRNA-Ser (GCT) (tRNA-Ser-GCT-4-1)
  23. Mustela putorius furo tRNA-Ser (GCT) (tRNA-Ser-GCT-4-1)
  24. Nomascus leucogenys tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1)
  25. Ophiophagus hannah tRNA
  26. Ovis aries tRNA-Ser (GCT) (tRNA-Ser-GCT-4-1)
  27. Pan troglodytes tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  28. Papio anubis tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  29. Petromyzon marinus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1, tRNA-Ser-GCT-1-2)
  30. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  31. Podarcis lilfordi tRNA.Ser
  32. Saimiri boliviensis boliviensis tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
2D structure