Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) microRNA mir-191 URS0000663EAF_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCAUUCCAGCUGCGCUUGGAUUUCGUCCCCUGCUCUCCUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Chlorocebus sabaeus microRNA mir-191
  2. Gorilla gorilla gorilla microRNA mir-191
  3. Gorilla gorilla (western gorilla) microRNA mir-191
  4. Homo sapiens microRNA mir-191
  5. Macaca fascicularis (crab-eating macaque) microRNA mir-191
  6. Nomascus leucogenys microRNA mir-191
  7. Pan troglodytes microRNA mir-191
  8. Papio anubis (Olive baboon) microRNA mir-191
  9. Pongo abelii microRNA mir-191
  10. Pongo pygmaeus microRNA mir-191
Publications