Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla gorilla (western lowland gorilla) U7 small nuclear RNA secondary structure diagram

Gorilla gorilla gorilla (western lowland gorilla) U7 small nuclear RNA URS0000661307_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCUGCAGCUCUUUUUAGAAUUUGUCUAGCAAGUUUUCCUGUUUUUACUGAAGCCUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Homo sapiens U7 small nuclear RNA
  2. Pan troglodytes U7 small nuclear RNA
  3. Pongo abelii U7 small nuclear RNA
2D structure Publications