Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 113-5 (SNORD113-5) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 113-5 (SNORD113-5) URS0000661285_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD113-5: SNORD113-5 is a component of the DLK1-DIO3 cluster and is a small nucleolar RNA (snoRNA) [PMC5796982]. The expression levels of SNORD113-5, along with other cluster components such as DIO3, SNORD113-7, SNORD114-9, and miR-889, were analyzed using qPCR [PMC5796982]. The results showed that the expression levels of these components were inversely associated with their methylation levels [PMC5796982]. In tumor samples, hypomethylation of SNORD113-5 and other components correlated with high gene expression compared to non-tumoral tissue [PMC5796982]. In patients with HBV infection, lower expression levels of SNORD113-5 were observed compared to patients without HBV infection [PMC9454744]. Additionally, in post-therapeutic LACC samples compared to pre-therapeutic LACC samples, SNORD113-5 was found to be upregulated along with other snoRNAs such as SNORD116-4 and SNORD114-1 [PMC6900565]. Furthermore, several snoRNAs including SNORD114-3 and SNORD113-8 were identified as key regulators by co-expressing with more than 150 mRNAs [PMC6900565]. These findings suggest that the expression levels of SNORD113-5 are influenced by methylation status and can be altered in various disease conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAUCAAUGAUGAGUAUUGGUGGAGGUGUCUGAAUCAACACUUUUGAUUAAGCCCUCUGUGUAACUCUGAGAUCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

2D structure Publications