Gorilla gorilla gorilla (western lowland gorilla) microRNA mir-146

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (western lowland gorilla) microRNA mir-146 URS000065B202_9595

87 nucleotides
1 database (Rfam)
Found in 9 other species
2299 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GUGUAUCCUCAGCUUUGAGAACUGAAUUCCAUGGGUUGUGUCAGUGUCAGACCUGUGAAAUUCAGUUCUUCAGCUGGGAUAUCUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Chlorocebus sabaeus microRNA mir-146
Fukomys damarensis (Damara mole-rat) microRNA mir-146
Heterocephalus glaber (naked mole-rat) microRNA mir-146
Homo sapiens microRNA mir-146
Macaca mulatta (Rhesus monkey) microRNA mir-146
Nomascus leucogenys microRNA mir-146
Otolemur garnettii microRNA mir-146
Pan troglodytes microRNA mir-146
Papio anubis (Olive baboon) microRNA mir-146

Publications