Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 66 (SNORA66) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 66 (SNORA66) URS0000656AFD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA66: SNORA66 is a small nucleolar RNA (snoRNA) that has been studied in various contexts. It has been used as a reference gene for normalization of qRT-PCR data in different studies [PMC7281098] [PMC7737439]. However, its expression level was found to be below the detection level in a large proportion of samples, leading to its exclusion from the analysis of expression level stability [PMC7281098] [PMC7737439]. SNORA66 is part of a family of small nucleolar RNAs that includes SNORA61, SNORA16A, and SNORD99 [PMC8107103]. It has been found to be both upregulated and downregulated in different studies. For example, it was downregulated in certain samples along with other snoRNAs, tRNAs, and miRNAs [PMC9321239]. On the other hand, it was upregulated in low-risk cohorts and served as a protective factor in DLBCL patients [PMC9939161]. SNORA66 has also been used as an endogenous control for miRNA expression normalization in qRT-PCR experiments [PMC7015979]. Additionally, it has been implicated in various biological processes such as DNA transcription and post-transcriptional modification of ribosomal RNAs (rRNAs) [PMC4831167] [PMC6123486]. However, more research is needed to fully understand the clinical value and regulatory mechanisms associated with SNORA66.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCAAACUCGAUCACUAGCUCUGCGUGAUGUGGCAGAAGCGAAGGGAACCAGGUUUGCAAAAGUAACUGUGGUGAUGGAAAUGUGUUAGCCUCAGACACUACUGAGGUGGUUCUUUCUAUCCUAGUACAGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

2D structure Publications