v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pteropus alecto (black flying fox) Small nucleolar RNA SNORD2 secondary structure diagram

Pteropus alecto (black flying fox) Small nucleolar RNA SNORD2 URS0000651282_9402

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAGUGAAAUGAUGGCAAUCAUCUUUCGGGACUGACCUGAAAUGAAGAGAAUACUCAUUGCUGAUCACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 53 other species

  1. Balaenoptera musculus small nucleolar RNA, C/D box 2 (ENSBMSG00010009083.1)
  2. Bison bison bison (American bison) snoRNA (ENSBBBG00000020306.1)
  3. Bos grunniens (domestic yak) small nucleolar RNA, C/D box 2 (ENSBGRG00000001722.1)
  4. Bos indicus x Bos taurus (hybrid cattle) snoRNA (ENSBIXG00000004678.1, ENSBIXG00005024388.1)
  5. Bos mutus (wild yak) snoRNA (ENSBMUG00000018014.1)
  6. Bos taurus Small nucleolar RNA SNORD2 (ENSBTAG00000044311.2)
  7. Callithrix jacchus (white-tufted-ear marmoset) snoRNA (ENSCJAG00000053654.2)
  8. Camelus dromedarius small nucleolar RNA, C/D box 2 (ENSCDRG00005006975.1)
  9. Camelus ferus Small nucleolar RNA SNORD2
  10. Canis lupus dingo small nucleolar RNA, C/D box 2 (ENSCAFG00020006161.1)
  11. Canis lupus familiaris snoRNA (ENSCAFG00000027814.2, ENSCAFG00030020406.1, ENSCAFG00040017636.1, ENSCAFG00845021673.1)
  12. Capra hircus (Goat) snoRNA (ENSCHIG00000003566.1, ENSCHIG00010011014.1)
  13. Catagonus wagneri small nucleolar RNA, C/D box 2 (ENSCWAG00000019781.1)
  14. Cercocebus atys (Sooty mangabey) snoRNA (ENSCATG00000017457.1)
  15. Cervus hanglu yarkandensis (Yarkand deer) small nucleolar RNA, C/D box 2 (ENSCHYG00000019512.1)
  16. Chlorocebus sabaeus (African green monkey) small nucleolar RNA, C/D box 2 (ENSCSAG00000026646.1)
  17. Choloepus hoffmanni snoRNA (ENSCHOG00000014805.1)
  18. Dasypus novemcinctus snoRNA (ENSDNOG00000027095.1)
  19. Delphinapterus leucas (beluga whale) small nucleolar RNA SNORD2 (ENSDLEG00000014413.1)
  20. Gorilla gorilla gorilla (Western Lowland Gorilla) small nucleolar RNA, C/D box 2 (ENSGGOG00000032407.2)
  21. Homo sapiens (human) small nucleolar RNA, C/D box 2 (ENSG00000238942.1)
  22. Loxodonta africana small nucleolar RNA SNORD2 (ENSLAFG00000027916.1)
  23. Macaca fascicularis small nucleolar RNA, C/D box 2 (ENSMFAG00000011567.2)
  24. Macaca mulatta small nucleolar RNA, C/D box 2 (ENSMMUG00000037192.3)
  25. Macaca nemestrina snoRNA (ENSMNEG00000014685.1)
  26. Mandrillus leucophaeus (Drill) snoRNA (ENSMLEG00000027856.1)
  27. Microcebus murinus (gray mouse lemur) snoRNA (ENSMICG00000043385.1)
  28. Monodon monoceros (narwhal) small nucleolar RNA, C/D box 2 (ENSMMNG00015002343.1)
  29. Moschus moschiferus small nucleolar RNA, C/D box 2 (ENSMMSG00000008065.1)
  30. Mustela putorius furo snoRNA (ENSMPUG00000021050.1)
  31. Myotis brandtii Small nucleolar RNA SNORD2
  32. Myotis davidii Small nucleolar RNA SNORD2
  33. Myotis lucifugus small nucleolar RNA SNORD2 (ENSMLUG00000021313.1)
  34. Neogale vison (American mink) snoRNA (ENSNVIG00000020214.1)
  35. Ovis aries snoRNA (ENSOARG00000022667.1, ENSOARG00020000498.2)
  36. Pan paniscus small nucleolar RNA, C/D box 2 (ENSPPAG00000013661.1)
  37. Pan troglodytes small nucleolar RNA, C/D box 2 (ENSPTRG00000037854.2)
  38. Papio anubis (olive baboon) snoRNA (ENSPANG00000034011.2)
  39. Phocoena sinus small nucleolar RNA SNORD2 (ENSPSNG00000006371.1)
  40. Physeter catodon small nucleolar RNA, C/D box 2 (ENSPCTG00005010832.1)
  41. Piliocolobus tephrosceles snoRNA (ENSPTEG00000011478.1)
  42. Pongo abelii snoRNA (ENSPPYG00000028034.2)
  43. Pteropus vampyrus (large flying fox) snoRNA (ENSPVAG00000024664.1)
  44. Rhinolophus ferrumequinum small nucleolar RNA, C/D box 2 (ENSRFEG00010010824.1)
  45. Rhinopithecus bieti (Black snub-nosed monkey) snoRNA (ENSRBIG00000015782.1)
  46. Rhinopithecus roxellana snoRNA (ENSRROG00000003033.1)
  47. Sciurus vulgaris small nucleolar RNA, C/D box 2 (ENSSVLG00005008914.1)
  48. Suricata suricatta small nucleolar RNA, C/D box 2 (ENSSSUG00005005885.1)
  49. Sus scrofa snoRNA (multiple genes)
  50. Theropithecus gelada small nucleolar RNA SNORD2 (ENSTGEG00000022950.1)
  51. Tursiops truncatus (bottlenosed dolphin) snoRNA (ENSTTRG00000023870.1)
  52. Vicugna pacos (alpaca) snoRNA (ENSVPAG00000015840.1)
  53. Zalophus californianus (california sea lion) snoRNA (ENSZCAG00015013248.1)
 2D structure Publications