Gorilla gorilla gorilla (western lowland gorilla) MALAT1-associated small cytoplasmic RNA/MEN beta RNA

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (western lowland gorilla) MALAT1-associated small cytoplasmic RNA/MEN beta RNA URS000064EB37_9595

57 nucleotides
1 database (Rfam)
Found in 6 other species
3 publications
ncRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GAUGCUGGUGGUUGGCACUCCUGGUUUCCAGGACGGGGUUCAAAUCCCUGCGGCGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Carlito syrichta (Philippine tarsier) snRNA (ENSTSYG00000034015.1)
Chinchilla lanigera (Long-tailed chinchilla) snRNA (ENSCLAG00000021377.1)
Heterocephalus glaber MALAT1-associated small cytoplasmic RNA/MEN beta RNA
Homo sapiens (human) snRNA (ENSG00000274072.1)
Nomascus leucogenys (Northern white-cheeked gibbon) MALAT1-associated small cytoplasmic RNA/MEN beta RNA
Pongo abelii MALAT1-associated small cytoplasmic RNA/MEN beta RNA

2D structure

Publications