v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA mir-154 secondary structure diagram

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA mir-154 URS000064D59F_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUAUUUAAAACGUGGAUAUUCCUUCUAUGUUUACGUGAUUCCUGGUUAAUCAUAGAGGAAAAUCCAUGUUUUCAGUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Chlorocebus sabaeus microRNA mir-154
  2. Gorilla gorilla gorilla microRNA mir-154
  3. Homo sapiens microRNA mir-154
  4. Macaca mulatta (Rhesus monkey) microRNA mir-154
  5. Pan troglodytes microRNA mir-154
  6. Papio anubis (Olive baboon) microRNA mir-154
 2D structure Publications