Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 105B (ENSG00000238531.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 105B (ENSG00000238531.1) URS000064B8EB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD105B: SNORD105B is a small nucleolar RNA (snoRNA) that has been implicated in various cancers, including B-cell lymphocytic leukemia (CLL), ovarian cancer, gastric cancer, and colon adenocarcinoma. It has been found to be upregulated in proliferating normal B-cells and CLL cells, suggesting its functional relevance in cell proliferation [PMC9219770]. In ovarian cancer, SNORD105B is part of a signature of nine snoRNAs that may serve as prognostic and therapeutic targets [PMC10050728]. In gastric cancer, SNORD105B is overexpressed and promotes tumorigenesis through the ALDOA/C-Myc pathway [PMC6584411]. It has also been associated with ER-negative tumors and triple-negative breast cancer (TNBC), as well as poorer outcomes [PMC9803687]. SNORD105B has been shown to bind to ALDOA and upregulate the expression of C-myc in gastric cancer [PMC9098889]. Additionally, SNORD105B is downregulated in tumor tissues compared to normal tissues in gastric cancer [PMC9119353]. Knockdown of SNORD105B attenuates the growth of gastric cancer cells [PMC8677010]. Overall, these findings suggest that SNORD105B plays a role in cell proliferation and tumorigenesis through various pathways.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCACAUGCGGCUGAUGACAGCACUUCUGCUGAGACGCUGUGAUUGCUCUGUCCAAAGUAAACGCCCUGACGCACUGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications