v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ameiurus melas (black bullhead) tRNA-Leu secondary structure diagram

Ameiurus melas (black bullhead) tRNA-Leu URS000064506B_219545

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUAGCGUGGCCGAGCGGUCUAAGGCGCUGGAUUAAGGCUCCAGUCUCUUCGGGGGCGUGGGUUCAAAUCCCACCGCUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Cathartes aura (turkey vulture) tRNA
  2. Danio rerio tRNA-Leu (AAG) (tRNA-Leu-AAG-9-1)
  3. Homo sapiens tRNA-Leu (anticodon AAG) 3-1 (TRL-AAG3-1)
  4. Megalops atlanticus (tarpon) tRNA-Leu
  5. Pangasianodon hypophthalmus tRNA-Leu
  6. Pelecanus crispus tRNA
  7. Perca fluviatilis (European perch) tRNA-Leu
  8. Xenopus tropicalis tRNA-Leu (AAG) (tRNA-Leu-AAG-4-1)
 2D structure