Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 73B (SNORA73B) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 73B (SNORA73B) URS00006422E6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

snora73b: SNORA73B is a small nucleolar RNA (snoRNA) that has been found to be overexpressed in Huh7 cells, a human liver cancer cell line, suggesting its potential involvement in cellular processes related to cancer [PMC8763008]. This snoRNA has also been observed to be downregulated along with other histone encoding genes and small nuclear ribonucleoproteins in certain contexts, indicating its participation in complex cellular mechanisms [PMC7191197]. In age-related macular degeneration (AMD), SNORA73B expression is elevated threefold in both retina and PRCS tissues compared to normal tissues, which implies a possible role for SNORA73B in the pathogenesis of AMD [PMC5813239]. Furthermore, SNORA73B is associated with the sirtuin SIRT7 and is found at higher levels within the coding region of its gene compared to adjacent genomic regions, suggesting that SIRT7 may interact with mature snoRNAs including SNORA73B [PMC4754350]. The molecular function of SNORA73B involves directing steps in the processing of pre-rRNAs to produce mature ribosomal RNAs (rRNAs), which are essential for protein synthesis [PMC8410784]. Additionally, overexpression of SNORA73B has been shown to inhibit expression of its host genes [PMC8763008], and its expression can be regulated by the AKT molecular inhibitor GSK2141795, linking it to the PI3K/Akt/mTOR signaling pathway [PMC8763008]. Despite being less explored as a prognostic factor in cancer compared to other genes, SNORA73B has been identified as a potential predictor for cutaneous melanoma (CM) outcomes [PMC7550331].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAACGUGGAUACCCUGGGAGGUCACUCUCCCCAGGCUCUGUCCAAGUGGCAUAGGGGAGCUUAGGGCUCUGCCCCAUGAUGUACAGUCCCUUUCCACAACGUUGAAGAUGAAGCUGGGCCUCGUGUCUGCGCCUGCAUAUUCCUACAGCUUCCCAGAGUCCUGUGGACAAUGACUGGGGAGACAAACCAUGCAGGAAACAUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications