Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) microRNA gga-mir-33 precursor (gga-mir-33-1) URS000063D20F_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-33: Gga-mir-33 is a microRNA found in chickens that plays a role in regulating fatty acid oxidation in the liver [PMC7936154]. It is homologous to gga-mir-33* [PMC3005926]. Studies have shown that gga-mir-33 targets enzymes involved in fatty acid oxidation, such as CROT, HADHB, and FTO [PMC7936154]. In the liver of newly hatched chicks subjected to a delay in feeding, the expression of gga-mir-33 is significantly lower compared to chicks that were fed from hatch [PMC7936154]. This suggests that gga-mir-33 may negatively regulate fatty acid oxidation when chicks rely on residual yolk lipids for energy production [PMC7936154]. The expression of gga-mir-33 increases from hatching through the first weeks of posthatch life [PMC7936154]. It has been predicted that gga-mir-33 targets various enzymes involved in metabolic signaling cascades and effector enzymes related to lipid metabolism [PMC7936154]. Gga-mir-33 has been found to regulate fat mass and obesity-associated (FTO) genes associated with obesity in chicken liver, similar to its function in mammals such as humans and mice [PMC7084605]. Studies have shown that gga-mir-33 is closely related to lipid metabolism and fatty acid oxidation by regulating FTO, CROT, and HADHB genes in chicken liver [PMC9714206]. Furthermore, gga-mir-33 and its host gene SREBF2 are highly expressed in the chicken liver, suggesting their involvement in upregulating genes related to cholesterol biosynthesis [PMC3675212].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUAGUGCAUUGUAGUUGCAUUGCAUGUGCUGGCAGUAACUGUGCAAUGUUCCUGCAGUGCAGUACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Publications