v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Glu (anticodon TTC) 1-1 (TRE-TTC1-1, TRE-TTC1-2) secondary structure diagram

Homo sapiens (human) tRNA-Glu (anticodon TTC) 1-1 (TRE-TTC1-1, TRE-TTC1-2) URS0000639DBE_9606

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCCAUAUGGUCUAGCGGUUAGGAUUCCUGGUUUUCACCCAGGUGGCCCGGGUUCGACUCCCGGUAUGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 41 other species

  1. Actinia equina (Beadlet anemone) tRNA tRNAscan-SE.tRNA.utg2024.Glu(TTC).8
  2. Actinia tenebrosa tRNA-Glu
  3. Albula glossodonta (roundjaw bonefish) tRNA
  4. Albula goreensis tRNA
  5. Amphiprion ocellaris (clown anemonefish) tRNA
  6. Amphiprion percula tRNA
  7. Arctogadus glacialis (Arctic cod) tRNA-Glu
  8. Atractosteus spatula (alligator gar) tRNA
  9. Boreogadus saida tRNA-Glu
  10. Collichthys lucidus tRNA
  11. Cottoperca gobio tRNA
  12. Dallia pectoralis tRNA-Glu
  13. Danionella cerebrum tRNA-Glu
  14. Danionella translucida tRNA
  15. Danio rerio tRNA-Glu (TTC) (tRNA-Glu-TTC-4 1 to 8)
  16. Dicentrarchus labrax (European seabass) tRNA
  17. Dissostichus eleginoides tRNA-Glu
  18. Dissostichus mawsoni tRNA
  19. Gadus morhua (Atlantic cod) tRNA
  20. Gadus morhua 'NCC' tRNA-Glu
  21. Gouania willdenowi (blunt-snouted clingfish) tRNA
  22. Gymnodraco acuticeps tRNA
  23. Hippoglossus stenolepis (Pacific halibut) tRNA-Glu
  24. Hucho hucho (huchen) tRNA
  25. Hymenochirus boettgeri tRNA
  26. Labrus bergylta (ballan wrasse) tRNA
  27. Leptobrachium leishanense (Leishan spiny toad) tRNA
  28. Menidia menidia (Atlantic silverside) tRNA
  29. Orbicella faveolata tRNA-Glu
  30. Pelobates cultripes (western spadefoot toad) tRNA.Glu
  31. Aquarana catesbeiana Rana catesbeiana (bullfrog) tRNA
  32. Rhinopithecus roxellana (golden snub-nosed monkey) tRNA
  33. Salmo salar (Atlantic salmon) tRNA
  34. Scophthalmus maximus (turbot) tRNA
  35. Silurus meridionalis tRNA
  36. Sinocyclocheilus anshuiensis tRNA
  37. Sinocyclocheilus grahami tRNA
  38. Synaphobranchus kaupii (Kaup's arrowtooth eel) tRNA
  39. Triplophysa rosa (cave loach) tRNA
  40. Xenopus petersii tRNA-Glu
  41. Xenopus tropicalis Xenopus (Silurana) tropicalis (western clawed frog) tRNA
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications