Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus musculus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1) secondary structure diagram

Mus musculus musculus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1) URS0000636E2A_39442

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUCGAUAGCUCAGUUGGUAGAGCGGAGGACUGUAGAUCCUUAGGUCGCUGGUUCGAUUCCGGCUCGAAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Ailuropoda melanoleuca tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  2. Balaenoptera acutorostrata scammoni tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  3. Bos taurus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  4. Callithrix jacchus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-7-1)
  5. Canis lupus familiaris tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  6. Cavia porcellus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  7. Ceratotherium simum simum tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1, tRNA-Tyr-GTA-2-2)
  8. Chlorocebus sabaeus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1, tRNA-Tyr-GTA-2-2)
  9. Choloepus hoffmanni tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  10. Cricetulus griseus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  11. Dasypus novemcinctus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  12. Dipodomys ordii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1, tRNA-Tyr-GTA-2-2)
  13. Echinops telfairi tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  14. Eptesicus nilssonii tRNA-Tyr
  15. Equus caballus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  16. Erinaceus europaeus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  17. Felis catus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  18. Gorilla gorilla gorilla tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  19. Heterocephalus glaber tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  20. Homo sapiens (human) tRNA-Tyr (anticodon GTA) 2-1 (TRY-GTA2-1)
  21. Ictidomys tridecemlineatus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  22. Latimeria chalumnae tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1)
  23. Macaca mulatta tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  24. Microcebus murinus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  25. Monodelphis domestica tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  26. Mus caroli tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  27. Mus musculus castaneus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  28. Mus musculus domesticus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  29. Mus musculus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  30. Mus pahari tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1)
  31. Mus spretus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2 1 to 3)
  32. Mustela putorius furo tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  33. Myotis lucifugus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  34. Nomascus leucogenys tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1, tRNA-Tyr-GTA-2-2)
  35. Notamacropus eugenii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1)
  36. Ochotona princeps tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  37. Oryctolagus cuniculus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1, tRNA-Tyr-GTA-2-2)
  38. Otolemur garnettii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  39. Ovis aries tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  40. Pan troglodytes tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  41. Papio anubis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  42. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  43. Pongo abelii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  44. Procavia capensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  45. Rattus norvegicus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1)
  46. Saimiri boliviensis boliviensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  47. Sarcophilus harrisii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  48. Sorex araneus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  49. Sus scrofa tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1)
  50. Trichechus manatus latirostris tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1, tRNA-Tyr-GTA-2-2)
  51. Tursiops truncatus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  52. Vicugna pacos tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
2D structure