v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Callithrix jacchus (white-tufted-ear marmoset) microRNA cja-mir-488 precursor secondary structure diagram

Callithrix jacchus (white-tufted-ear marmoset) microRNA cja-mir-488 precursor URS0000634C1B_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGAAUCAUCUCUCCCAGAUAAUGGCACUCUCAAACAAGUUUCCAAGUUGUUUGAAAGGCUAUUUCUUGGUCAGAUGACUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA 488 (ENSANAG00000015039.1)
  2. Cercocebus atys (Sooty mangabey) microRNA 488 (ENSCATG00000009193.1)
  3. Chlorocebus sabaeus (African green monkey) microRNA 488 (ENSCSAG00000021974.1)
  4. Colobus angolensis palliatus miRNA (ENSCANG00000006500.1)
  5. Macaca fascicularis (Crab-eating macaque) microRNA 488 (ENSMFAG00000009243.2)
  6. Macaca mulatta microRNA mml-mir-488 precursor
  7. Macaca nemestrina microRNA 488 (ENSMNEG00000008422.1)
  8. Mandrillus leucophaeus microRNA 488 (ENSMLEG00000003544.1)
  9. Nomascus leucogenys microRNA 488 (ENSNLEG00000022301.2)
  10. Papio anubis microRNA 488 (ENSPANG00000026902.3)
  11. Piliocolobus tephrosceles miRNA (ENSPTEG00000009735.1)
  12. Pongo abelii microRNA 488 (ENSPPYG00000021061.2)
  13. Pongo pygmaeus microRNA ppy-mir-488 precursor
  14. Rhinopithecus bieti (Black snub-nosed monkey) microRNA 488 (ENSRBIG00000010850.1)
  15. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 488 (ENSRROG00000001368.1)
  16. Saimiri boliviensis boliviensis microRNA 488 (ENSSBOG00000018299.1)
  17. Theropithecus gelada (gelada) microRNA 488 (ENSTGEG00000002256.1)
 2D structure Publications