Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pangasianodon hypophthalmus tRNA-Leu secondary structure diagram

Pangasianodon hypophthalmus tRNA-Leu URS0000630B8A_310915

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUAGCGUGGCCGAGCGGUCUAAGGCGCUGGAUUAAGGCUCCAGUCUCUUCGGAGGCGUGGGUUCGAAUCCCACCGCUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  2. Albula goreensis tRNA-Leu
  3. Anguilla anguilla (European eel) tRNA-Leu
  4. Ceratotherium simum simum tRNA-Leu (AAG) (tRNA-Leu-AAG-1-1)
  5. Chlorocebus sabaeus tRNA-Leu (AAG) (tRNA-Leu-AAG-1-1)
  6. Dallia pectoralis tRNA-OTHER
  7. Eptesicus nilssonii tRNA-Leu
  8. Eurypyga helias tRNA
  9. Gorilla gorilla gorilla tRNA-Leu (AAG) (tRNA-Leu-AAG-1-1, tRNA-Leu-AAG-1-2)
  10. Homo sapiens tRNA-Leu (anticodon AAG) 1-1 (TRL-AAG1 1 to 3)
  11. Latimeria chalumnae tRNA-Leu (AAG) (tRNA-Leu-AAG-1-1)
  12. Lepisosteus oculatus (spotted gar) tRNA
  13. Loxodonta africana tRNA-Leu (AAG) (tRNA-Leu-AAG-1-1)
  14. Macaca mulatta tRNA-Leu (AAG) (tRNA-Leu-AAG-1 1 to 3)
  15. Merluccius polli tRNA-Leu
  16. Monodelphis domestica tRNA-Leu (AAG) (tRNA-Leu-AAG-2-1)
  17. Mustela putorius furo tRNA-Leu (AAG) (tRNA-Leu-AAG-1-1)
  18. Myotis brandtii tRNA
  19. Myotis davidii tRNA
  20. Myotis lucifugus tRNA-Leu (AAG) (tRNA-Leu-AAG-1-1)
  21. Ochotona princeps tRNA-Leu (AAG) (tRNA-Leu-AAG-1-1)
  22. Ophiophagus hannah tRNA
  23. Oryctolagus cuniculus tRNA-Leu (AAG) (tRNA-Leu-AAG-1-1)
  24. Pangasianodon gigas (Mekong giant catfish) tRNA-Leu
  25. Pan troglodytes tRNA-Leu (AAG) (tRNA-Leu-AAG-1-2)
  26. Papio anubis tRNA-Leu (AAG) (tRNA-Phe-AAA-1-1)
  27. Pongo abelii tRNA-Leu (AAG) (tRNA-Leu-AAG-12-1)
  28. Rattus norvegicus tRNA-Leu (AAG) (tRNA-Leu-AAG-1-1, tRNA-Leu-AAG-1-2)
  29. Takifugu rubripes tRNA-Leu (AAG) (tRNA-Leu-AAG-1 1 to 3)
  30. Vicugna pacos tRNA-Leu (AAG) (tRNA-Leu-AAG-1-1)
2D structure