Callithrix jacchus (white-tufted-ear marmoset) microRNA mir-216

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) microRNA mir-216 URS00006307B0_9483

89 nucleotides
1 database (Rfam)
Found in 1 other species
329 publications
pre_miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GGCUGUGAGUUGGCUUAAUCUCAGCUGGCAACUGUGAGAUGUUCAUACAAUCCCUCACAGUGGUCUCUGGGAUUAUGCUAAACAGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Gorilla gorilla gorilla (western lowland gorilla) microRNA mir-216
Homo sapiens microRNA mir-216
Pan troglodytes (chimpanzee) microRNA mir-216
Pongo abelii microRNA mir-216

Publications