Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) microRNA mir-322 URS0000630758_9593

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Chlorocebus sabaeus microRNA mir-322
  2. Gorilla gorilla gorilla microRNA mir-322
  3. Homo sapiens microRNA mir-322
  4. Macaca mulatta (Rhesus monkey) microRNA mir-322
  5. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA mir-322
  6. Pan troglodytes (chimpanzee) microRNA mir-322
  7. Papio anubis microRNA mir-322
  8. Pongo abelii microRNA mir-322
  9. Pongo pygmaeus (Bornean orangutan) microRNA mir-322
Publications