Pongo abelii (Sumatran orangutan) U6 spliceosomal RNA (ENSPPYG00000027520.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo abelii (Sumatran orangutan) U6 spliceosomal RNA (ENSPPYG00000027520.2) URS000062E3F9_9601

107 nucleotides
2 databases (ENA, Ensembl)
Found in 4 other species
1. sncRNA
2. snRNA
3. u6 snRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AGGCUCACUUUGGCAGCUCAUACACUAAAACUGGAGCCAUACAGAAAAGAUUAGCAUGGCUCCUGUGCAAGUAUGACAUGCAAAUUCAUGAGAAUUCCAUAUUUUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Gorilla gorilla gorilla U6 spliceosomal RNA (ENSGGOG00000030845.2)
Homo sapiens U6 spliceosomal RNA
Pan paniscus (bonobo) U6 spliceosomal RNA (ENSPPAG00000005750.1)
Pan troglodytes (chimpanzee) U6 spliceosomal RNA (ENSPTRG00000036735.2)

2D structure