Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) Small nucleolar RNA SNORD81 (ENSG00000212278.1) secondary structure diagram

Homo sapiens (human) Small nucleolar RNA SNORD81 (ENSG00000212278.1) URS000062DDA5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD81: SNORD81 is a small nucleolar RNA (snoRNA) that is encoded within the Small Nucleolar RNA Host Gene 2 (SNHG2) or Growth Arrest Specific 5 (GAS5) gene located in the 1q25.1 region [PMC9598326]. SNORD81 is one of several snoRNAs hosted by SNHG2, including SNORD44, SNORD47, SNORD76, SNORD78, SNORD79, SNORD80, SNORD74, SNORD75, and SNORD77 [PMC9598326]. It has been reported that chromosome regions gained in Huntington's disease patients exhibit transcriptional imbalances in snoRNAs including the expression of SNORD81 [PMC3511933]. Additionally, sdRNAs derived from snoRNAs such as SNORD44 and especially from the GAS5-encoded C/D box snoRNA loci including SNORD81 have been found to be upregulated and associated with metastatic disease [PMC8389557]. In prostate cancer patients, the expression of snoRNAs such as SNORD44 and SNORD81 has been found to be upregulated [PMC6163368]. Furthermore, sdRNAs derived from snoRNAs such as SNORD44 and SNORD78 have been found to demonstrate strong differential expression in cancer [PMC9149963]. In a study on embryo viability biomarkers, it was found that SNORD81 was exclusively present in media from viable embryos [PMC7072903]. The expression of SNORD44 and SNORD78 has also been validated by quantitative real-time PCR (Q-PCR) in clinical samples of prostate cancer patients [PMC4627319]. The nucleolytic cleavage of C/D box snoRNAs like SNORD74 and especially SNORD81 requires different conformational states possibly assisted by structural interaction with core snoRNP or unidentified proteins [PMC4627319]. In lung cancer patients, snoRNAs such as SNORD81 have been found to be significantly decreased in plasma compared to healthy donors [PMC7461500]. Overall, SNORD81 is a snoRNA that has been implicated in various diseases and has potential as a biomarker [PMC9598326][PMC3511933][PMC8389557][PMC6163368][PMC9149963][PMC7072903][PMC4627319][PMC7461500].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGAUAUACGAUAAUCUCACUCCGACUUAAACUCUCUCACUGAUUAUUUGAUAAUAACAGGUCAGAUAUUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications